Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13272E11
Clone ID IST13272E11
Vector VICTR74
Project tigm

Sequence tag IST13272E11BBF1
Sequence
TCCCAATTAACCACCATGACAGCAGGGAGGTAGGAAGGCAGGCAGGCTGAGAGAAGGGAAAGCGGCACACTTATCACAGA
AGAGCTTGTTCTCCCCAGGGTCTCCTTCTCCTCAAGTAGGCTCCAAGAGTTCAGAGGTCCAAACAACTGTAAAGCTCTAA
AGCCGAGGTTCAAATGCTGTTCTTAGTCACGGCAGAAGCCTTTCTCTGTACTGGTACTTTANTGTTTANTTCTCTAAAAA
TCCCTGGCCCGGGGGCGGGGGGAGCACGGGCCAAANTGATGGCTCATTGGTTAAGANCACTCTTCCANNNGACTGGAAGT
TCANTTCCCAGTACCTACNTGGCAGCTCACAACTGTCNGTAACTCCANTTCCAGGGGANCTGATACCCTNACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88365889..88366281 365
 
EST/CDNA Est Name
  CN832233.1 - CK346071.1 - BY089054.1 - CJ120554.1 - BU512397.1 - BF142788.1 - CA870310.1 - CJ103141.1 - CJ100421.1 - BE911686.1 - CJ102560.1 - CJ100143.1


Sequence tag IST13272E11HMF1
Sequence
CTCTTTCTGCTTAAAAGGAGGATTGATTGCTACACAGGGAAAAGGCTCTCCAGCTAGGCTAANAACGAGACCNGGAGTTC
CAGCCTCCTCCCAAAACGGGCCAGGGGTGGTTTGTGAATTTGATACCCANAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22430006..22430143 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es