Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10916H8
Clone ID IST10916H8
Vector VICTR76
Project tigm

Sequence tag IST10916H8HMF1
Sequence
GGAACGTNNGTTTTGTCGGTTTAGGATGGGTTGGGAAGATTACTCGTAAAAATCTAGTTGCGAACTATAAGTNACTCTTC
CCTTGGAGCCGCGATGTCGGCATTTACCTTGATATAGCCAAATGACTGGCAAGGCCTGTCCGTTTTGTCTCGACGCCTGC
CCCGNACCTTGCCCCCGCGGGCTTATGGGAACTGTANTCCCCCGGCGCTTCCGGACACCTTCCTCTGTAGGCTGGCGTAN
TCCCCCTCCGGTTCCGGTTCGGTTTTTCCTTGNANCCCACCCTTCCTGTGTGTGGCGGAAGTTCCTTTCTTCCGGATTGC
GTTTGGGGCGTCTCCNAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22923579..22923913 319
NO GENE  


Sequence tag IST10916H8HMR1
Sequence
GTTCCCAGCGGGGCGTCCTTGAAATTTCCAGGCCACGGCACTCTACGCCTGCGGGGAGCTTCCTAAGTGCCTACAACGCG
GGCATTACGTTGTTCACCGACCATCTCCATCCCTAGCCTCCGGCGGAGCTGGACGTGGCTGTGCCTGTCTCCTGGGCCTG
GAGAGTGGGTAGTGGAGGTGTTGCNCAGCNNGN
Sequence Type genomic DNA
Unitrap ID UNI36455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22923909..22924097 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es