Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14652H1
Clone ID IST14652H1
Vector VICTR74
Project tigm

Sequence tag IST14652H1BBF1
Sequence
ATCTGTGGATCGTTCCCTAACAGGGACATACAATCCAGCTACCCTGACATTTAACGTTGGCTGCTTTCTGTCCCAGCTCA
ACACAGTCAAGTGTTCTTCAGGTCATAGTGAGAGCAGACAGACCCATGAAAATTAACTACCAACAGCCACCAATTTGAAA
ACAAGGACCGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAG
CAACCACATGGTGGCTCACAACCACCCGTAATGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689757..29690036 280
NO GENE  


Sequence tag IST14652H1HMF1
Sequence
ATCTGTGGATCGTTCCCTAACAGGGACATACAATCCAGCTACCCTGACATTTAACGTTGGCTGCTTTCTGTCCCAGCTCA
ACACAGTCAAGTGTTCTTCAGGTCATAGTGAGAGCAGACAGACCCATGAAAATTAACTACCAACAGCCACCAATTTGAAA
ACAAGGACCGGGCTGGTGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689800..29690036 237
NO GENE  


Sequence tag IST14652H1HMR1
Sequence
AGATAATAAANAAAGGTAACTGTNNTTTGACAGTCACATAGCCTTAGTGGCCTTGAGAAGAAACAAGGAATTCTCAAATG
AAGCTTCTCAAAGATTCTATCCCAAAGCCTGGTTN
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29690033..29690146 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es