Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10040B1
Clone ID IST10040B1
Vector VICTR75
Project tigm

Sequence tag IST10040B1HMR1
Sequence
NATCTGTCTTGCTTATNAGGAAGTCCTACAAGCAAGCTCCCAGTGGCCTCTCAGGCTTCCCAAGGAACAGGGTCCCCTAT
TCCTAAGATTCATGGAAGTAGTTTTTTGACATCTACTGTGAAGGTAAACTGTCCCTGCTTTACTATATTGCGCAAGCTCA
GCGGGGGTGCTACCCAAAGACAGCATTTGATCCTGAAGATTATTTCTTCTTCACTTTCTTCCTGATATAGGAGACAGTGC
TCAACACATCTCTCANGTGCTTACCCAGTACTANTTGAANGCTCAGTACGGGAAA
Sequence Type genomic DNA
Unitrap ID UNI33042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20190441..20190733 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es