Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0243
Clone ID AD0243
Vector pGT0lxr
Project sanger

Sequence tag AD0243
Sequence
TTTTTTTTCAAGGGCAATCATCAGGTCTGTGGTCTACCAGCAGAGTTCCAAAGAGTCAGCTACTCTGCAACTGTTTTTCA
CGCTGCAGTTGGACATCCAGTCTGACAAGATACGCACAGTCCAGGATGCGCTGGAGAGCTTGGTGGCCAGGGAGTCTGTC
CAAGGTTACACCACCAAAACCAAGCAGGAG
Sequence Type mRNA
Unitrap ID UNI2376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122477056..122477245 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es