Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14257E11
Clone ID IST14257E11
Vector VICTR74
Project tigm

Sequence tag IST14257E11BBF1
Sequence
CTTACATATAATAAATAAATAAATCTTTAAAAAAAGAGGAAAAAATATATATATTTATTGTATGTATATGAGTACACCAT
TGATCTCTTCAGACACACCTGAAGAGGGCATCAGATCCCATTACAGATGGTCATGAGCCACCATGTGGTTGCTGGGAATT
GCACTCANGACCTCTGGAAAAGCAGTCGGTGCTCTTAACCACTGAGCCATCTCTCCAGCCNCTCCCCCCCACAACCTGCA
TTCTTATGCAACTCANGGCCACCTTCCCAGGNGTTGTACCCCCNACAGTGGGCTGGGGCCTCTCCCAAAATCATTACTAC
NTAGAATGGACCCCANACTTGCATACNAGCTNATCTGATAGANGTATTTTTCTNNNTGGANGTTTCTGTTNANTTTNNAA
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14257E11HMF1
Sequence
CTTACATATAANAAATAAATAAATCTTTAAAAAAAG
Sequence Type genomic DNA
Unitrap ID UNI11927 UNI30971 UNI36459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9681177..9681212 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025912 (Mybl1) NM_008651 myeloblastosis oncogene-like 1 Gene [Source:MGI Symbol;Acc:MGI:99925]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 25608080..25608115 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 41479331..41479366 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7315906..7315941 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62600920..62600955 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12896831..12896866 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 40998003..40998038 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3014571..3014606 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26251523..26251558 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 47488122..47488157 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3064030..3064065 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71309727..71309762 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 18144851..18144886 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 37481275..37481310 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 106209429..106209464 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046079 (Lrrc8d) NM_178701 leucine rich repeat containing 8D Gene [Source:MGI (curated);Acc:Lrrc8d-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 120265147..120265182 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20515191..20515226 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25965907..25965942 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037437 (Adam32) NM_153397 a disintegrin and metallopeptidase domain 32 Gene [Source:MGI (curated);Acc:Adam32-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 56750568..56750603 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49680742..49680777 34
NO GENE  

 
Come back to gene ENSMUSG00000037437


For any suggestions or comments, please send an email to unitrap@crg.es