Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST437482
Clone ID OST437482
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST437482
Sequence
GACCTCTGCTGGCCGACNCGNTCTGGACTGCTGCAGTCTGCTCAAGAGGAGCTGACCAGGAAGGAGGCAGCTGATCCAGG
AACTGCAACACAAGTTAAACCAGGAGAAGGAGGAAGTGGAGCAGAAGAAGAATGAGTTCAGCTTGAAGATGAGGCAGCTG
GAGCACGTGATGGGCTCTGCTACCGAGTATCCACAGAGTCCCAAAACACCACCCCATTTTCAAGCTCATTTGGCAAAACT
CTTGGAAACACAAGAACAAGAGATAGAAGATGGAAGAGCCTCTAAGACTTCTTTGCAACACCTTGTAACAAAGCTAAATG
AAGATAGAGAAGTCAAAAATGCTGAAATTCTCAGAATGAAGGATCAATTGTGTGAAATGGAAAATCTACGCCTGGAGTCT
CAGCAATTAAGAGAGAAAAACTGGCTCCTGCAACGTCAGCTGGATGATGTGAAAAGGCAGCAGGAGAGTGGCGATCAGAG
TCATCCAGACAGTCCCC
Sequence Type mRNA
Unitrap ID UNI8040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122916507..122923080 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036768 (Kif15) NM_010620 kinesin family member 15 Gene [Source:MGI Symbol;Acc:MGI:1098258]

 
Come back to gene ENSMUSG00000036768


For any suggestions or comments, please send an email to unitrap@crg.es