Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14159F9
Clone ID IST14159F9
Vector VICTR74
Project tigm

Sequence tag IST14159F9HMR1
Sequence
AAATCNCACCACAGATATGTTTCGCCTACCTGCAAAGAAAGATGTGAGGCTTGCCAGTGTGCTTANAATATCTTTTATTA
AAAAAAATAGTAGTAGTAGTAATAATAATAACAATAACAATAACTATAATATCAACAACAAGAAAAAATTTCTATTTGAA
CCATTTGGGACCACTTGGTATTAACAACAACAACAATTCCATTTGGACCATTTGGGAAACCAACTTGGTATTGCCTAGGA
AGGGATGAGTAACTTCGTTACATAGACTGACCACCCTAGCTTCTACTCAAAGACCTACNCTCTAAATAGAAGCGGCTGTG
GCTGCTAAGGAACTGAAGTCCTGTGGTCCCCATTTTGCGTTTTGTTGTTGTTGTTGTTGTTATTGTTGTTGTTGNTNGGT
TTGGTCNNNNNNGGAAATCCTACTTNATGGNGAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28160030..28160463 408
NO GENE  


Sequence tag IST14159F9HMF1
Sequence
NNNNNATAGTTCCTAGCATGAGTTTTAAACAGGAGATGGTGTGTGAGTCTGAGTACAGATGCACCCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI25304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28160465..28160531 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]

 
Come back to gene ENSMUSG00000021895


For any suggestions or comments, please send an email to unitrap@crg.es