Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14525E2
Clone ID IST14525E2
Vector VICTR74
Project tigm

Sequence tag IST14525E2BBF1
Sequence
ATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTGACTCTGTTTAGATATTGTTCTTCT
GGTGATTCTGTTACCGTCTATCAGCAGACCTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCAGAGCACTCTCTGC
TGGCAAGCTCTCTTACAGGGAAGGTGCGCAGATATCTTGTATTTGGACCTTCTCCTGGCCGAAGAAGAAGGCCCAAAANN
NNNNNNTTCTCAGACACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGT
TCCTTGGAGTCCCGGGACCAAGANGGCGACCGCTGCTGCTGTGGCTTANGCCGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66035862..66036235 354
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103855031..103855404 354
NO GENE  


Sequence tag IST14525E2HMF2
Sequence
ATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 91514523..91514578 56
NO GENE  


Sequence tag IST14525E2HMR1
Sequence
TNNGAATCTTACTAACAGGAACCAAGACCACTCACCATCACCANAACCCANCACACCCACTTCGCCCAGTCCAGGGAACC
CCNNCACACCTGAGAACCTANACCTAGATTTAAAAGCATATCTCATGATGATGGTAGAGGACATCAAGAAGGACTTTAAT
AAATCACTTAAAGAAATACAGGAGAACACTGCTAAAGAGTTACAAGTCCTTAAAGAAAAACAGGAAAACACAATCAAACA
GGTAGAAGTCCTTACAGAAAAAGAGGAAAAAACNTACNAACAGGTGATGGAAATGAACAAAACCATACTAGACCTAAAAA
GGGAAGTANACACAATAAAGAAAACTCNNAGCGAGGCN
Sequence Type genomic DNA
Unitrap ID UNI30565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7324068..7324421 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255204..5255557 334
 
EST/CDNA Est Name
  AA799267.1 - BY669328.1 - CJ236159.1 - BU743333.1 - BY570162.1 - DT912046.1 - BB808667.1 - AA088077.1 - CB272803.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826064..7826417 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689285..9689638 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4073757..4074110 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3176340..3176693 334
 
EST/CDNA Est Name
  AV043105.2 - BF458004.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369244..4369597 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14814592..14814945 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11691717..11692070 334
 
EST/CDNA Est Name
  AW121696.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10880771..10881124 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20828735..20829088 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7842758..7843111 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054519..5054872 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5641133..5641486 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3986863..3987216 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 9094420..9094773 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110061..5110414 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912472..3912825 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4770768..4771121 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025892 (Gria4) NM_019691 glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48388..48741 334
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134298..134651 334
 
EST/CDNA Est Name
  AU017122.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4905963..4906316 334
NO GENE  

 
Come back to gene AU017122.1


For any suggestions or comments, please send an email to unitrap@crg.es