Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11822A10
Clone ID IST11822A10
Vector VICTR76
Project tigm

Sequence tag IST11822A10HMF1
Sequence
CTGGATTATGTTTTCAAAAATAGTGTCTATACATGTAGTATTCACAATATTTTCTGACCTAATCTCTAGGAAGCATTATT
TCCATGAACTCAGTACTTTTCATTTATTTATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI29416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29815988..29816105 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029772 (Ahcyl2) NM_021414 S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI (curated);Acc:Ahcyl2-002]

 
Come back to gene ENSMUSG00000029772


For any suggestions or comments, please send an email to unitrap@crg.es