Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14983D10
Clone ID IST14983D10
Vector VICTR76
Project tigm

Sequence tag IST14983D10HMF1
Sequence
GTCCTGTGTCCTAGCATCACTGCGCATGCTCTTTTGATCTAAAAAGTGTGAGCTACTGTACCACATGCCTGCTTTGGTCA
CAGCGCATGCTATCTAAACTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 93842033..93842132 100
NO GENE  


Sequence tag IST14983D10BBF1
Sequence
GTCCTGTGTCCTAGCATCACTGCGCATGCTCTTTTGATCTAAAAAGTGTGAGCTACTGTACCACATGCCTGCTTTGGTCA
CAGCGCATGCTATCTAAACTGTTTTAGAGAGGTTAGGGAGTTACCATCTCTCCCCAACAGATGTTAGTCACAACAACAGA
TCAAGCCCAGGTTGGGTACATGTGGCTCAGCGCTAGTGCTTGCTAAGCCACGAGACCCTGGGTTTGACCCTAGAACTGCC
AAAAGAGGAGTGGGGGAGCCAATGTTTACTAAAGGCCAAACACAAACACACACACACAGACATACACACATCANCCAGCG
TTGTTAAGCAGATATCATGCATTATTTAATTTACTTAATTAACACAAGCATCTTATAATTTATGTCCTATTAGAGAAAAT
CTAGNATNACAGANTCNCTGANGTATAATTTGCTCAAAATTAACAATTGCTTGGAATACTGAANCAAGCAACCNANNCCA
CNTTATANAANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 93842033..93842522 466
 
EST/CDNA Est Name
  DT930163.1 - AA615671.1 - CX224453.1 - BQ573027.1 - BF121421.1 - BI153975.1 - BI409552.1 - BY756495.1 - AA138044.1 - BG085623.2 - CK137527.1 - CF585079.1 - AI181035.1


Sequence tag IST14983D10HMR1
Sequence
GACTTGTTGGTACCATAGTCTTTTTTNATGAGGTCCACTCCCCATAATCTGCTTTTTGAGACTTTTTGGGTTTTGCCATG
AGTGAAACAAACAGATGGAACTCCTTCCCTCCCCAGAGCCTTTACCCTGCTGTCCCTGCCAGCATGCCTTATTTCCTCTG
TAGCCCTTCCAGGTTCTCCTANCCACCTCCCATTTCCTGTCTGAGGAAGGGACTGGGGTCATCCCTCCTCTCCTTTTGTT
CCCCATGCTCCTCGCACAGGGCAGGCACACAATGGCTGGTAGCAGGCGCGCCTCACCCANCANCAACTGTCTCAANANCC
CTGTATTTTCTTTCTCANATGTAACTTATCCGCAACCAAGACTTACNGCATGGTATGGAGC
Sequence Type genomic DNA
Unitrap ID UNI36463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 93841629..93842008 364
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040174 (Alkbh3) NM_026944 alkB, alkylation repair homolog 3 (E. coli) Gene [Source:MGI (curated);Acc:Alkbh3-001]

 
Come back to gene ENSMUSG00000040174


For any suggestions or comments, please send an email to unitrap@crg.es