Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10007C12
Clone ID IST10007C12
Vector VICTR75
Project tigm

Sequence tag IST10007C12HMF2
Sequence
TTAGTTTCCCGTTACTAAGGAACAAATGATAAGATTTGGGTCATTTCCCAACGTTAAGGATTCTGGAGGAGGGAGTTCTG
TTTTTATTTGCAGTGTGTGTGTAATAGGTTTTTCTTATATCTTATAGTCTTTTCTTATATAGTCCAGGATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74841041..74841193 153
NO GENE  


Sequence tag IST10007C12BBR1
Sequence
TGGGATTAAAGGCGTGTGTCACCATGCCTGGCTTTCTTTACAGTTTTCGACTACACTAGTTCTAGAGATTTCTCTTTGTT
TTGTGGTGACATAATTTAGAGTCCTAGGCACGCTAGCTGAGCACTTTACCCCTGAGCTACATCCCCAGCCCTTTGCATGG
CATGGCTTTTGGTAGCAGCTCTATTAAGATAGATCC
Sequence Type genomic DNA
Unitrap ID UNI21090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69502370..69502564 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es