Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14577D5
Clone ID IST14577D5
Vector VICTR74
Project tigm

Sequence tag IST14577D5HMF2
Sequence
CCCCCATTCAGCCTCTTCAGNTACTCTTGTGCTGTGCAGCAGTGGCGCTGTGTGTAAATGCTATGCACTGAGGATACACA
AATATGACGTGTACAGGATAATGCCTCATACAAATCAGATGTCCATTTGTTACTGTGTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 97727384..97727526 135
 
EST/CDNA Est Name
  AA450527.1 - DV073594.1 - AV071666.1 - CX121908.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32897607..32897749 135
 
EST/CDNA Est Name
  CX121908.1 - AV071666.1 - DV073594.1 - AA450527.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66347545..66347687 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038664 (Herc1) hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 Gene [Source:MGI (curated);Acc:Herc1-001]

 
Come back to gene ENSMUSG00000038664


For any suggestions or comments, please send an email to unitrap@crg.es