Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11406G5
Clone ID IST11406G5
Vector VICTR76
Project tigm

Sequence tag IST11406G5HMF1
Sequence
NTAAGTATTTAAGATCAAAGATTCCTTCAATCCACTANTGGACTGCTTTCACCAGTATAAGCTTTGGGATACAAAGTGGT
TACTTAANAGAGCAGACAGACAACTCAAGAAAGGAAACAGCCAACAAGCCCCTCTGACTAANAGCTGACACTCACAAGAC
AGTCACTGAACAATANAAGCAGCCGCTCCTCCAAGACAACGTATTTCANGGATGGTAATATTTTCTTCCACTTGGTTGAT
CGGGATGCCAACAGACAGCCCACATCATCNGAAGCANGAACTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121132566..121132848 269
NO GENE  


Sequence tag IST11406G5BBF1
Sequence
GTAAGTATTTAAGATCAAAGATTCCTTCAATCCACTANTGGACTGCTTTCACCAGTATAAGCTTTGGGATACAAAGTGGT
TACTTAANAGAGCAGACAGACAACTCAAGAAAGGAAACAGCCAACAAGCCCCTCTGACTAAGAGCTGACACTCACAAGAC
AGTCACTGAACAATAGAAGCAGCCGCTCCTCCAAGACAACGTATTTCAGGGATGGTAATATTTTCTTCCACTTGGTTGAT
CGGGATGCCAACAGACAGCCCACATNANNNNAANCAGGAACTGGCCAAGGGGGACCTAGAATTTACATCTGCTGAACTCT
TCACTCCACACTACCTCCTNAAGACTTAAATGATATTNNAAGACACAAAATTNGGGGGACTGGAGCTACAGTTAAATACT
TACNAGTACTGNTGCTCTTGCAGANAACCTGGGTNAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121132409..121132849 409
 
EST/CDNA Est Name
  CX734624.1


Sequence tag IST11406G5HMR1
Sequence
CTTACAATCNGTAAAATTCCTAGGCAGCATCTTTGAAAATAACATTTATCTGGAAAGATGCCAATGCATTGCANAAACAT
ATAAGCTTCTTTAAAAGGGCAGGGGGGGTGGCGGCAAGAAAATATGAAAACCTGGATTAGAAAAAAATAGACTTGTTGCG
TTGCGAACACATTCGCTGTTTCTGCTTTGCTTTTTTGAGACTGATTATCACTGAGTTAAGGCTGGTCTTGAATTCATTTT
CCAAGAATGATCNGNAACTCCTGATCCTGCCCCCGCCTCCCANTTGANAGCTGGNATTACNNATATGCACACACCGTANC
TGGN
Sequence Type genomic DNA
Unitrap ID UNI1457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121132845..121133167 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]

 
Come back to gene ENSMUSG00000053931


For any suggestions or comments, please send an email to unitrap@crg.es