Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14887C6
Clone ID IST14887C6
Vector VICTR76
Project tigm

Sequence tag IST14887C6BBF1
Sequence
ATGATCAACCCATTAATGTAGGAGGTTTCCCTCAATTTTATGGCAAATTAATCAAACCTAGGTGAAGGTTACAGGAATCC
TGCTTTGCAGCCAGTGGGTCAAAAGCACAGGGAGAGGGGCAGGGGACCTAAAAGCCAGGCACTAACTCATGATTGTAATC
CCAGGAAGTAGGGTGCTGANATAGAAGGACTACTGTGAATTTAAAGCCAACCTGGACTAAAGTGAACTCAAGGCTACCCT
AGGCTAAANACNAAATCCTGCTGTAAAAAAANAAAGTGATTATCANTANNNTTCNCTTGGTANAACATTTGCCCAAAGGA
AGATTTGGGTTCNATTCNNNGGACTGNNNNNNCNANGCATGCNNGGCACCCTCAATGTGTGCNNNGCNCTATNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14887C6HMR1
Sequence
ATCATGAAGGGTATAATTAGGGATAGAGGAAGCTTAGAGAAAGGTGTCGGGCTTTGGTGGCTGCCACAGGGAAATCCTCC
TGGAACCTCCAGTTTCAGCCTCGCCTTTTTGGTCAAATGTTTATAAAGCGCAGGCAGACCTTGAATTGTAATCTCTCTCT
TCNGCCNGNNNNTGCTTGGGATTANAGGTGN
Sequence Type genomic DNA
Unitrap ID UNI4261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115368898..115369087 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020737 (Hn1) NM_008258 hematological and neurological expressed sequence 1 Gene [Source:MGI (curated);Acc:Hn1-001]


Sequence tag IST14887C6HMF2
Sequence
AGAGGATGGCAGAGACTTAAAGCAGAGGTTGTAGTTATAGCCTATCCATACTGTTGAGAAAATACAGTTTTCACTTCAGT
GACTTTAATCCTGCTTATGAATTTAGCTTTTTATTTTCTCTCACTCTTTANTTTTTTTAATCTTTTTTTTCTTTTTTCTT
TTTCTTTTTTGCCGAAATTAACTATTTGGTGAAGTCTGTGGAGCCTCCTTGCTTTGCATGTGTGATGTGCCNNGCCAGCN
TAGGAGAGCANGTGGAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI14707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143143019..143143279 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029578 (Wipi2) NM_178398 WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI (curated);Acc:Wipi2-001]

 
Come back to gene ENSMUSG00000029578


For any suggestions or comments, please send an email to unitrap@crg.es