Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12905F6
Clone ID IST12905F6
Vector VICTR76
Project tigm

Sequence tag IST12905F6HMF1
Sequence
CAGGTTCAATTCCCAGCACCCACATGGCAGCTCACAGAGCCAGTTCCAGGGGGCCCAACACCCTCACACAGATACCAGTG
AAGCCAAAAAACTAGAGTATGTAAATAAAACTGAATATAAACTAGAATATGTAAATAAAACTAAATCATTTAAAAATTTT
TAAATATTGCTGGTAAAGGGAAAATTGCTTATAGAATTGGTTGTAGATGGATAATAAAAATAATCACAAAGTTGTGCTCA
CTATGTACTTTATGGAAATTCATTCATTCATTCATTCATCCCTCATTACACATCTGGGTTTTTCCATTATCACTTTACCT
GANCCCAAAGTTAANGCCAGGGCCCAGACCATGTAATATGAAGCATTCTGGCGGCAGGGAACTNNNTCGGATTCCATGGT
CTGNACCTATTGATTATGTAAACTTANCTTCCATTTCCTCATCTGTAAACAGTTAGCTGTAGTGTCNCTCNCCGCACAAA
ANANANNNANATCTTCCNAAGCNAATATN
Sequence Type genomic DNA
Unitrap ID UNI12953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38450901..38451408 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002844 (Adprh) NM_007414 ADP-ribosylarginine hydrolase Gene [Source:MGI Symbol;Acc:MGI:1098234]

 
Come back to gene ENSMUSG00000002844


For any suggestions or comments, please send an email to unitrap@crg.es