Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13802A10
Clone ID IST13802A10
Vector VICTR74
Project tigm

Sequence tag IST13802A10BBF1
Sequence
ACCCTAAAAATTCCACCAGANAACTCCTAAACCTGATAAACAGCTTTGGTGAAGTANCTGGATATAAAATTAACTCAAAC
AAGTCAATGGCCTTTCTCTACACAAAGAATAAACAGGCTGAGAAAGAAATTAGGGAAACAACACCCTTCTCAATAGTCAC
AAATAATATAAAATATCTCGGCGTGACTCTAACTAAGGAAGTAAAAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI11782 UNI31095 UNI32923 UNI36467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16903272..16903484 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 83622120..83622332 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13851153..13851365 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 11042392..11042604 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 65507377..65507589 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 17489383..17489595 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 11158457..11158669 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047497 (Adamts12) NM_175501 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12 Gene [Source:MGI Symbol;Acc:MGI:2146046]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 27428859..27429071 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038127 (Ccdc50) NM_001025615 coiled-coil domain containing 50 Gene [Source:MGI (curated);Acc:Ccdc50-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37613551..37613763 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 22601919..22602131 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045215 (Asxl3) additional sex combs like 3 (Drosophila) Gene [Source:MGI (curated);Acc:Asxl3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21136758..21136970 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19881042..19881254 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4822392..4822604 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10666018..10666230 209
 
EST/CDNA Est Name
  CA586534.1 - AA666609.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 10824769..10824981 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 42077717..42077929 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 65848356..65848568 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25957807..25958019 209
 
EST/CDNA Est Name
  AV039669.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 39222319..39222531 209
 
EST/CDNA Est Name
  AA666609.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161916: 397942..398154 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4910288..4910500 209
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2685378..2685590 209
NO GENE  

 
Come back to gene AA666609.1


For any suggestions or comments, please send an email to unitrap@crg.es