Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST437214
Clone ID OST437214
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST437214
Sequence
GTAACCCAGCACAGGAATGTAGGCACCAGCCNAGCTCATGGTATACCTACAGCGCTTCAGGCCTCTGGACTATCAGCGCC
TGCTAGAAGCAGCCAGTTCTGGTGAGGCCACAGGGGACTCAGCATCCTGACAACAGCGTTCACTTTCCAAAAGGGAAGGT
AACTCTGAAGCCGCCATTCACATCCGGACCCACGGTGCTCCTTTCCCTTACAACGGAGCCACTTTCCCCTCCAGCTCTGC
CTGGTCTTTCGCCCACTCTGAGCTATCCTTCCTGGAGCCCTCCCTGGCTGCTTCCCTCATCCGTCAGATGCAATCTGTGG
GCCGCCCCTCTCCCCTGGCCGCTAAGCAGCCTCCATTGATTTCCGCTCGTGTTTATAGGATTTCCACTTAGCCGTGATCA
GTAGTTNAGCACAGGAAAATCCCTTGCCACCCCCCCCTCCNTTGGTCGATGCCATTNNATTCTGCCAGAGGCTCTGAA
Sequence Type mRNA
Unitrap ID UNI17735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55716222..55716691 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045691 (Thtpa) NM_153083 thiamine triphosphatase Gene [Source:MGI Symbol;Acc:MGI:2446078]

 
Come back to gene ENSMUSG00000045691


For any suggestions or comments, please send an email to unitrap@crg.es