Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST437208
Clone ID OST437208
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST437208
Sequence
ACACCGGTGTAGTACCCAGTGCTCCTTGGCGGGCCAGCTTTATGCAGTGCCCCTCATNCAGCCCGACCTGCGACGAGAGG
AGGCAATCCAGCAAGTGGCAGATGCCCTGCAGTACCTACAGAACATCTCTGGAGACATCTTCAGCAGGATCTC
Sequence Type mRNA
Unitrap ID UNI17736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66463211..66463357 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024101 (ORF19) NM_001037757 open reading frame 19 Gene [Source:MGI Symbol;Acc:MGI:1916017]

 
Come back to gene ENSMUSG00000024101


For any suggestions or comments, please send an email to unitrap@crg.es