Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10742B11
Clone ID IST10742B11
Vector VICTR76
Project tigm

Sequence tag IST10742B11BBF1
Sequence
CTTTCACCTGTTGTCTGTCCCAGGAATGCAAGTGGCCAGATATATNANNAGAACCGACCGCCTCCCTGGAAGAAAGGGGC
TCCCGTGGCAGCCTGGTTGCCTCTGGCCTCCCTCAGATGGAAACAACCTGTGCAGGCGGCAGCTGGAACACCAACCTCCC
CACAGCTGACTCCAGTCCGCCCACTGCCTGGTTAGTTGCCTTCCACCTACCCAGCTGCCAGGGGCAGGTGCACCGTGCCT
TTAAACACACTTTTGCCCCTTTCCTTCCAATANCCCTAANCANCTTGCTTTTTTATTGTATCTGAAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI12986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120713748..120714051 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es