Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13702E6
Clone ID IST13702E6
Vector VICTR74
Project tigm

Sequence tag IST13702E6BBF1
Sequence
CCATGTCTCCTTCAGAGGATGCTTGGACCTGAAGTTGGAGGAGCTGAAATCCTTTGTTCTGCCATCCTGGATGGTTGAGA
ANATGCGGAAATACATGGAGACACTGCGGACAGAAAATGANCACCGCGCTGCGGAAGCGCCTCCCCAGACCTGAGCCGGG
TGTCCTGGCTACTACACTTGGCGGCCTGCCTCCAAGACCCTCTTTCCCCACCCGGCTGAGGCCATCATGGGGATTTGGTC
TAGTTGACTCTTAACAGCATTAANCTGTACATGAGCTAGTTTGTANTGACTCANTGCNNANNANCNNNNACTGGCATGTG
GTTCTGTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13702E6HMF1
Sequence
CCATGTCTCCTTCANAGGATGCTTGGACCTGAAGTTGGAGGAGCTGAAATCCTTTGTTCTGCCATCCTGGATGGTTGANA
AAATGCGGAAATACATGGAGACACTGCGGACAGAAAATGAGCACCGCGCTGCGGAAGCGCCTCCCCAGACCTGAGCCGGG
TGTCCTGGCTACTACACTTGGCGGCCTGCCTCCAAGACCCTCTTTCCCCACCCGGCTGAGGCCATCATGGGGATTTGGTC
TAGTTC
Sequence Type genomic DNA
Unitrap ID UNI35695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164593348..164593592 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es