Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13571B5
Clone ID IST13571B5
Vector VICTR74
Project tigm

Sequence tag IST13571B5BBF1
Sequence
TTTGGGGGCTCNTCCGGGATCNGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13571B5HMR1
Sequence
GAAAGACAACCTTGTGAGAGTCCCACTGAGAATCAGACTAGAGGCCATTTGTAGACATTCTGGCAAGGAACTTGGAAAAT
CAATAGACAGCATGGATGGGGGACATGTGACATAATGTGACAGGGCTCTTGTTGAAGACAGACCAGGGTCACCAGACACC
TTCTGGGAAGGGTGCGTTTAATAAGGTGCCATAGGTGTTCAGGTATCAGAGTAGTCTGAAGTCTCTTGTTAAAGACAGGA
CTACTTTGACAGGCACCGTTGTATAGGAGCCCTGCTTCAGAAGGGGGTCAGAGGAGCCTGGTCAGAGTTAGGAGT
Sequence Type genomic DNA
Unitrap ID UNI4724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31715219..31715533 315
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006705 (Pknox1) NM_016670 Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

 
Come back to gene ENSMUSG00000006705


For any suggestions or comments, please send an email to unitrap@crg.es