Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14950G7
Clone ID IST14950G7
Vector VICTR76
Project tigm

Sequence tag IST14950G7BBF1
Sequence
GCACTTAAATAATCCCTTTCCTCCTCAAGATGCTTTTGGTCTCGGTGTTTCATCACAGCAACAGAAGCCCTAAGAGTAGT
CCTAAGTGAGACACTTGGTTTTGTTTGTTTGTTTGTTTGTTGGTGGGGAGTGAGAATCTGCTAATGTTTTCTAATGTCCA
AATCATTTTTTCCATAGAAGATATTTAAGTAGATGGTTTACCATCATCCAAAGTTACACAAGGAAAAGAAGACAGAGAGG
ATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81067283..81067525 243
NO GENE  


Sequence tag IST14950G7HMF1
Sequence
NCACTTAAATAATCCCTTTCCTCCTCAAGATGCTTTTGGTCTCGGTGTTTCATCACAGCAACAGAAGCCCTAAGAGTAGT
CCTAAGTGAGACACTTGGTTTTGTTTGTTTGTTTGTTTGTTGGTGGGGAGTGAGAATCTGCTAATGTTTTCTAATGTCCA
AATCATTTTTTCCATAGAAGATATTTAAGTAGATGGTTTACCATCATCCAAAGTTACACAAGGAAAAGAAGACAGAGAGG
ATCCATTCAGCTAAAATCTTGTGCATGTTGTTTCATTCTTTGATGGCTTCNAAAATGCACAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81067219..81067524 304
NO GENE  


Sequence tag IST14950G7HMR1
Sequence
TGCTTACATATTCNGAATCCCAGTCCATTGAGGGAAGCCAAGGCAGGGACTCACACTGGGTAAGAACCTGGGGACAGGAG
GTGATGCAGAGGTCATGGTGGGTGCTGCTTACTGGCCTGCTCCTCGTGGCTTGCANAGCCTGCTTTCTTACANAACCCCC
CACCATCTGCCCAGGGGTGGTGCTACCCATAATGGGCTGGGCCCTCCTCCATCAATCACTAAATAANACAAGGCCCTACA
TGCCTGCCCCTANCCTACTCANAGGCATTTTCTCAATTGAAATTCCTTTCTCTCTGGTGATTCATTCTANCTGTATCANG
TTC
Sequence Type genomic DNA
Unitrap ID UNI30536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81067523..81067844 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es