Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12686E5
Clone ID IST12686E5
Vector VICTR76
Project tigm

Sequence tag IST12686E5BBF1
Sequence
TAAGTACACTGTATCTGTCTTCAGACACTCCAGAAAAGGGCATCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 111943961..111944010 50
NO GENE  


Sequence tag IST12686E5HMF2
Sequence
AAACTGGTGATACAGAGCTATAGAGAGAAACCCTGTCTTAGACTGGAAAAAAGGCAAACAAAACCAAAACTTATTGAATG
AAAGTTAGATGTAATACAAAAAACTATAGGAATTGGTTTTGTGTGTGACAGAGGGTGGTGCNNGCGTN
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6057819..6057965 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es