Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14692G7
Clone ID IST14692G7
Vector VICTR76
Project tigm

Sequence tag IST14692G7HMF2
Sequence
GATTCAACTTCCCATCCATTCCTCTCATCTTAAGTCCATCCTTTAGTTGCAATAACTACTGTATCACATGACAAAATCGT
TCCCCCAGGGCCCAGTACAGACAAGACCTTCCTGAGCATCCTTGCTCTTCACTGTCAAGCCCTCTTGGTACTTGACAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90583074..90583230 157
NO GENE  


Sequence tag IST14692G7HMR1
Sequence
AATNNAAGGCCATCTTCAGAAAGGACAAAGGTCTAAGTATTGATGGAGGGGCCACGATTCTCTGTTCACATGACTCANNT
NNCTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90583227..90583303 73
NO GENE  


Sequence tag IST14692G7BBF1
Sequence
AAGCTTANGNNNTANANNGGTTTACATGTAGAGATCATTTGAAAAGTTCTGCTTCCAGCATATTTAGGTATGCTGAGCTG
TCTTGTGGCTACATATTAGTTTTAGGAATCAGCCCACAACTCTGAAGAGGCAAGTTTGGTAGGTAAAATAAGTTATGGAA
TCTCTCTTTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20189986..20190160 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es