Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14429G11
Clone ID IST14429G11
Vector VICTR74
Project tigm

Sequence tag IST14429G11HMF1
Sequence
CACCTCTAACCAAGAAGCTCCTTGTAAGTGAGAGAAGAAACTCGGTTTTCTCCAGTAGGGTGATCCTGGCTGTATCAAGC
GCACTACAGAGCAGGCCTCCTGCTCAGCAGCCACTGACAGAGCCGGCAGACTCTACTGCTCTCTGTGTGCTTGTTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94816166..94816324 159
NO GENE  


Sequence tag IST14429G11HMR1
Sequence
GAACTTTGTGCACACTTCCTCTCTTGCTGGGATTTTTGTCTGGATGGTATTTGTTTAGGTCTTATGTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI14917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94816325..94816396 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074897 (CT030190.9) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3USJ7]


Sequence tag IST14429G11BBF1
Sequence
CCNCCTCNNACCAAGAAGCTCCTTGTAAGTGAGAGAAGAAACTCGGTTTTNNNNNGTAGGGTGATCCNGGCNGTATCAAG
CGCACTACAGAGCAGGCCTCCTGCTCAGCAGCCACTGACAGAGCCGGCAGACTCTACTGCTCTCTGTGTGCTTGTTTGTT
GACTGAAAGGTANAGAGAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074897


For any suggestions or comments, please send an email to unitrap@crg.es