Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15058C2
Clone ID IST15058C2
Vector VICTR80
Project tigm

Sequence tag IST15058C2HMF1
Sequence
ATGTATCAGGATTTTCCCTGTCCAATTATATTAGTGCAGAGGAGGCCTGTGATTGGACAGGGAAAAGGGAGGCGGAGCTA
AGAGTTGCAGAGACAGGAAGCATCTAAGATGGCGGTAGATGTGAACCCACATGGCGTTTACCAGCCACAAGTAGTTGTGA
GTATAGAATAGTTGGGGTAAAGCTTTATCATTATCAATTGGTTCTGAAATTATTGTACTGGCTTCTTGCAAATTGTGATA
TTATTGATACATAAATCTGATTGGATTGGTTAGTTAAGCTTTAAGGATCTTGATTTTACCTGGTTATTGGGTATTGTGAT
ATGCAACCACGAGGTTGGCGGTTCCATTTAGTTACTGGAATGTGGGATCGCTGACTACNCGGGTTTCTGGCTGAGGAANA
ACTNNCGGCTCCAGGGACNNNCNAACAAGGGCTGGNAGTGCANTGNACGGGCANANNGNGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21749030..21749482 429
NO GENE  


Sequence tag IST15058C2HMR1
Sequence
CNTGTGTCCNAAGACTTCCTAAGATATATATACATTTGAAGACTACCTTCCTTTTGAAAAAGTCATAGCTCANAAACGTC
AGGAAAGAAAAGCAAAAGAGCTGTGAAGTGTAAACACAGTTTACTTGTTTTGTCATCATGGGATCATGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGNGCGCGCGCGCGCGCA
Sequence Type genomic DNA
Unitrap ID UNI2811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21749482..21749684 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047368 (5730446C15Rik) NM_146096 family with sequence similarity 108, member B Gene [Source:MGI Symbol;Acc:MGI:1917816]

 
Come back to gene ENSMUSG00000047368


For any suggestions or comments, please send an email to unitrap@crg.es