Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11384D7
Clone ID IST11384D7
Vector VICTR76
Project tigm

Sequence tag IST11384D7HMR1
Sequence
ATACTTTCTGCTTTCTCTTGTGTGTGCGTTTTAAGTTCCCTCCTCTGTACAAAAATATCCCATCGTGCGGATTGTTGGTG
TTACTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI17538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35987758..35987851 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048970 (C1galt1c1) NM_021550 C1GALT1-specific chaperone 1 Gene [Source:MGI (curated);Acc:C1galt1c1-001]

 
Come back to gene ENSMUSG00000048970


For any suggestions or comments, please send an email to unitrap@crg.es