Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436924
Clone ID OST436924
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436924
Sequence
AAAGGGATATCTCCCACAGTGNGGTTTCACCGGCTGCTGTCTCTCCCGCACATCCTGTCCCCAAGCGCATAAAGAAGCCA
NTACTANGNGANGACAGGCATTGTGCCGNACTGGGGAGACAGCATATAAGTGANGGATGAAGATCAGATTCAAGGGCTTC
NTGAGGCTTGTCGGCTGGCGAGACACGTCCTCCTCCTGGCTGGGAAGAGTTTAAAGGNTGACATGACAACTGAAGAGATA
GATGCGCTTGTTCATTGGGAAATCATCAGGCATGACGCATATCCCTCACCTCTGGGCTATGGACGCTTTCCAAAATCTGT
TTGCACCTCTGTAAACAACGTGCTCTGTCATGGCATTCCTGACAGCCGACCTCTTCAGGATGGAGATATTATCAACATTG
ATG
Sequence Type mRNA
Unitrap ID UNI17755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71344935..71350220 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041921 (Metapl1) NM_025633 methionine aminopeptidase-like 1 Gene [Source:MGI (curated);Acc:Metapl1-001]

 
Come back to gene ENSMUSG00000041921


For any suggestions or comments, please send an email to unitrap@crg.es