Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14571D7
Clone ID IST14571D7
Vector VICTR74
Project tigm

Sequence tag IST14571D7BBF2
Sequence
TTGGAAGAAATGAACAGTTCATTATTTGACTCAAATGAGCTATTATAAAACACTACTTTGCTACACTCTTTAACTCAAGA
ATTTAGGAATTTATATCAAGAGGAAAGCAAGGTCATTGCCCTGGGGAGCAGCAGACCAGGATCAAGGCTACCTGAGTCAA
CATAGCTTGTCTTAGAAACATCTTTATAAGGGGAAAAAGAGACAGCTCTCCCAGAATTAACATGTCATCCCAGAAAGCAA
TCNCTGCNTATACAACTAAATATTAATTANTAAAAATTCTTAATGGCATCATGGATTCAGCTGTGGCTAATGCTCAAAGA
CCANCCNNCNNAAAACAGGTTTTTTGGATTCCACATATGCTCTCACCCATAAGTGTCNNNNNNGTTNAGTCCCCAGGTTA
NTTTGANCNNNTNNAATATGGACTGGAGANNACAAGTCNNANTTNNNACAGCTANGAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14571D7HMF3
Sequence
TTGGAAGAAATGAACAGTTCATTATTTGACTCAAATGAGCTATTATAAAACACTACTTTGCTACACTCTTTAACTCAAGA
ATTTAGGAATTTATATCAAGAGGAAAGCAAGGTCATTGCCCTGGGGAGCAGCAGACCAGGATCAAGGCTACCTGAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176867020..176867176 157
NO GENE  


Sequence tag IST14571D7HMR1
Sequence
CCACCTTCAGTAGAGAACAAGAGCAATGGTTTACTGTTATCTCTGTCAGGTGAAGTAGGGCAGGAGATGGCTAGATTATA
GACGAAAGCTTATGGATATCTGCTCCAGGTGTCACCACTCTAGTGAAGGATAAGTGTCAGGCAGGGTGAATAATTTTGTA
ATTTAACAGCATGTATTAAATAATGCATGTGATTAAATAAAACTAGATTGGTGGGTTCTTAATTTGTGCAGGTTANCTTG
AGCCANTGATAATGAATTTCTGTTTTAGGATCTGTACTATATAGATATAATGTATCANAAATGTAAAACACATGCCATTA
GCTGGAGCTGTGTGTGTCACATTATANATCTCNNTNNTTC
Sequence Type genomic DNA
Unitrap ID UNI4932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176867174..176867525 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es