Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11709B6
Clone ID IST11709B6
Vector VICTR76
Project tigm

Sequence tag IST11709B6BBF1
Sequence
GGAGTTCTCTGGGTAGAGAGCAGAGCTCCCCTCGGAACTAGAGCTTTTTCTCGTGCTCTTCAGGAAATGCCATTGCAATG
ACTTCCATANACTGTTTCCTGTCCCGGCCCAGCAGCCGGATTCCTGCTGCANAGTGTGGAAACTGGAAAGTAGTGTCCCG
AGAGGCATGCCCCCTACTTTTTTTTTATGCCCTTCCCTTTCCTCTTTCNGTCACTTTCTCTGCTCTCATTCCCTTCCCCT
TCACCTANTCTCTCCCTCCANTCCTANTCTGTACTCTTCCCTTTANAACTGGGAATGCCTTTCTAGTAGGTCTGCCTNTG
ATGCTANACTGTGTGGTCAGTTGGAAAAAACTCCCGGCCNTTGTCCCTGGCTCCATCNNTTATAAACTCTCCCCTANNNG
GGCATTANNCCTGTCACTTGGGAGTGCCCTGTGTCATCCATGANCTGATTTCTCCCTTGGGTTCTGACCCATCCATTCGG
GCATAGGACAGAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152646531..152647027 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]


Sequence tag IST11709B6HMF1
Sequence
GGAGTTCTCTGGGTAGAGAGCAGAGCTCCCCTCGGAACTAGAGCTTTTTCTCGTGCTCTTCAGGAAATGCCATTGCAATG
ACTTCCATANACTGTTTCCTGTCCCGGCCCAGCANCCGGATTCCTGCTGCANAGTGTGGAAACTGGAAAGTANTGTCCCG
AGAGGCATGCCCCCTACTTTTTTTTTANGCCCTTCCNTTTCCTCTTTCANTCACTTTCTCTGCTCTCATTCCCTTCCCCT
TCACCTATTCTCTCCCTCCANTCCTANTCTGTACTCTTCCCTTTANAACTGGGAATGCCTTTCTAGTAGGTCTGCCTNTG
ATGCNNNACTGTGTGGTCAGTTGGAAAAAACTCCCGGCCNTTGTCCCTGGCTCCATCNNTTATAAACTCTCCCCTANAGG
GGCATTANNCCTGTCACTTGGGAGTGCCCTGTGTCATCCATGANCTGATTTCTCCCTTGGGTTCTGACCCATCCATTCNG
NCNTANGACAGANGATCCTAAGGGAAGTATCCNAGGTTCTGCACTNNNNACCCTGCTTCTNGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es