Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436890
Clone ID OST436890
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436890
Sequence
GCCCCAGTCCGCTGAGCCCGAGCCCCATCCCCAGTCCTAACGTGAAACTTGAGAATTCCACTCTCCTGACAGTGGAGCCC
TCACCGCTGGACAAGAACAAGTGCTTCTTCGTGGACGAGTCAGAGCCCCTTCTGCGTTGCGACTCCACATCCAGTGGCCT
CTTCAGCACTGAGCAGAAACCGGCTCCTTTATTACCAAAGAAAAGAAGGACACAGTGTTGCGGCAGGTCCGCCTGGACCC
CTGTGACTTGCAGCCCATCTTTGATGACATGCTGCATATCCTGAACCCCGAGGAGCTGCGGGTGATTGAAGAGATTCCCC
AGGCTGAGGACAAACNTGGACCGCCTNTTCGAGATCATTGGGGTCAAGAGCCAAGAAGCCAGCCAGACCCTCTTGGACTC
TGNGNACAGNCATCTTCCTGACCTATTGTAGAACACAGGGGCACTGCATTCTGGGAATCACCCTACTGGCGGGGTGATTT
A
Sequence Type mRNA
Unitrap ID UNI16411

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 43222316..43224970 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023915 (Tnfrsf21) NM_178589 tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]

 
Come back to gene ENSMUSG00000023915


For any suggestions or comments, please send an email to unitrap@crg.es