Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13603B6
Clone ID IST13603B6
Vector VICTR74
Project tigm

Sequence tag IST13603B6BBF1
Sequence
GGGCTATACAGAGAAACCCTGTCTCCAAAAACCAAA
Sequence Type genomic DNA
Unitrap ID UNI1776 UNI7956 UNI11678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88235287..88235322 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32512604..32512639 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54348078..54348113 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037533 (Rapgef6) NM_175258 Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI (curated);Acc:Rapgef6-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 5495029..5495064 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28967301..28967336 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 31374258..31374293 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4004919..4004954 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24364192..24364227 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072082 (Ccnf) NM_007634 cyclin F Gene [Source:MGI Symbol;Acc:MGI:102551]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 45656627..45656662 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 41978970..41979005 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30910501..30910536 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121683545..121683580 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 109450205..109450240 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 109946424..109946459 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61049224..61049259 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28171377..28171412 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86646655..86646690 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21430660..21430695 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 36195..36230 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34181762..34181797 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059708 (Sfrs17b) NM_001081956 splicing factor, arginine/serine-rich 17b Gene [Source:MGI (curated);Acc:Sfrs17b-001]

 
Come back to gene ENSMUSG00000059708


For any suggestions or comments, please send an email to unitrap@crg.es