Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14374B5
Clone ID IST14374B5
Vector VICTR74
Project tigm

Sequence tag IST14374B5BBF1
Sequence
CTAGAAAGGGGTCCTTGAAAGAGAAGAAGAGAGCTTAAGGAGGAGGAAGGTACATGAATTCAAGTCAGAGAAGCAAAAAG
TTGCCAACAAAAAGAGGTGGGGGGAGAACAGCAGGAGTCAGGAAATGGAAGCAACTGGAGAAGTTCAGTAAGAACAAAGT
ATGAGTGAGAGCAGAGTAAGGAAACCTATTGCTTTGTATGCTAACTGTAAAGCCCAAGTACTAAGCCAGCTTAGTAAAAT
GGCTTAGCAGCAGAAGGCCAATCCTGCAAAGGCTGACATGGCTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22006970..22007257 288
NO GENE  


Sequence tag IST14374B5HMF1
Sequence
CTAGAAAGGGGTCCTTGAAAGAGAAGAAGAGAGCTTAAGGAGGAGGAAGGTACATGAATTCAAGTCAGAGAAGCAAAAAG
TTGCCAACAAAAAGAGGTGGGGGGAGAACAGCAGGAGTCAGGAAATGGAAGCAACTGGAGAAGTTCAGTAAGAACAAAGT
ATGAGTGAGAGCAGAGTAAGGAAACCTATTGCTTTGTATGCTAACTGTAAAGCCCAAGTACTAAGCCAGCTTAGTAAAAT
GGCTTAGCAGCAGAAGGCCAATCCTGCAAAGGCTGACATGGCTGGATCCCTAGGAAGGAGAACCAACTCCATAAAGTTGA
TACCTGACTTCTACCCATGAGTCAGGATGTACACACACNTATAAACATTTAAAAATAAGAGTAATAAAACATTAANCNTN
ATNNNTNAANNTGAGTGTTTCATANTNNNGTNANCNTTGTGGTGANNANNCACCNTGACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14374B5HMR1
Sequence
NTNNACATCCCCACCCCTAATAATACTTGTAAAAGAACTAAATTCTAGGATTTGCATAGGGAGAAAATGTGGTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22007259..22007331 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es