Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14663E3
Clone ID IST14663E3
Vector VICTR74
Project tigm

Sequence tag IST14663E3HMF2
Sequence
ATGTACCTTAGGAGTTTGGAAAGATAAAATGAGCTTTCACTTAAATTTTTTCCCTGACAATTTCCTCATTATAAATTTGA
CATTTTCATTAAAGTCTAAGTAATCATTATACGAAAGGCCAAAGCCTCTACGCTACCCTATCAGAATATAAGTATCTAAT
TATTAGAACACGTGTCTAGTACTCTTTACAACGCTTGCATAGTATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97127957..97128191 235
 
EST/CDNA Est Name
  BY150403.1 - BY148671.1 - BY148715.1 - BY329885.1


Sequence tag IST14663E3BBF1
Sequence
CCATGAAGGTTAAGGCAGCAGGCTGCCACAAGTTCAAGGACCTCCTATGCTATACAGTAAGTCTGAGACCGGCTTGGGCT
ATAGGGTAAGATCCCGTGTCATATAAATAAAATGAAGGCACTAATAAAAATATATTCTCTAAACCATCAACCANTGGTCT
ATAAATTACTATATTAATGAGAGGCATTTTAGGGGGCTGGTGAGATGGCTCAGCAGGTAAGAGCACCCAACTGCTCTTCC
AAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCNTCCGTAACAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30860319..30860622 300
 
EST/CDNA Est Name
  BQ958207.1


Sequence tag IST14663E3HMR1
Sequence
NGGTACTAGGATTGTANGAATTTGACAACANAGCAGAAAATGTATTTTTAATACATTCCATGCCTGAAGTTTTTCTCTCT
CCATATCTTACTTTANGCTTTTTATTTGGCACAGTGCCTACATGAAAATAGTATAAATAGTTCATTTCAACTATTACGCT
GTCGTTTGATGTTTTGTTTTCTGCTTTTGTTTTTGGTTTTTTTAGGATAATTCAGATTCATTGCATCCTTGAAGNGCATC
AATAGANNAGGGAAAAAANNNATGGNTGTNANNNCNTTTNCNCN
Sequence Type genomic DNA
Unitrap ID UNI14180

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 30860621..30860888 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047412 (CT025653.7-201) NM_172765 Zinc finger and BTB domain-containing protein 44 (BTB/POZ domain-containing protein 15) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0A2]

 
Come back to gene ENSMUSG00000047412


For any suggestions or comments, please send an email to unitrap@crg.es