Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436755
Clone ID OST436755
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436755
Sequence
TGAGGAAGCTGATGGGACTCTGGNTGCATCAGCATGGCTCTGACCTGCACCTTTAACAGGTGGGGCACACTGCTTGCTGT
TGGCTGTAACGATGGCCGGATTGTTATTTGGGATTTCTTGACCAGAGGCATGGGGCCAGGCTGGGTTGACAGGCCTGGTG
CACCTCCTATCTGAAGATGTCGGCTCAGGGGAGTGCACACCTACCGAGTCTTGATAGCCACTGTGATATTTCTTGCCAAT
TCTGTCTCTGCCTGGGGAAGTTCCTGGTCTGTTCTGTGCTCAGAGGCANCAAATTTTTAATTTTTTTATTACAAGA
Sequence Type mRNA
Unitrap ID UNI17765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27390438..27390630 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026917 (Wdr5) NP_543124 WD repeat domain 5 Gene [Source:MGI (curated);Acc:Wdr5-001]

 
Come back to gene ENSMUSG00000026917


For any suggestions or comments, please send an email to unitrap@crg.es