Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436604
Clone ID OST436604
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436604
Sequence
AACCTGGATGGAGAANATATGCTGCANAGCAGACCCTGGAGGATGTTTTCCTTCGAAAGTTTATGATGGGCACCTTTCCC
GGCTGCCTGGCTGACCAGATTGTTCTGAAGCGCCGGGCCAACCAAGTGGACATCTGTGCCCTGGTCCTCAGGCAGCATGC
CAGCACACAAATTCTACTTCCTCGTGGGCTACAGTGAGACTCTGTTGTCACACTTTTACAAGTGTCCTGTGCGACTCCAC
CTGCAAACTGTGCCCTCCAAGGTCGTGTACAAGTACATATAAAAAGTGCACGTTTTCTCCAGTAGAGCCTACAAGGTCAC
AGAGGNGCANGAGACCAAATGCCTGNTCTCTGAGGTGGAGGCGACAGCTCCAAGCTGCTGTTGAATAAAACCCTGATCAT
GTTTTGTCAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5604327..5604733 379
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020477 (Mrps24) NM_026080 mitochondrial ribosomal protein S24 Gene [Source:MGI (curated);Acc:Mrps24-001]

 
Come back to gene ENSMUSG00000020477


For any suggestions or comments, please send an email to unitrap@crg.es