Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12369F4
Clone ID IST12369F4
Vector VICTR76
Project tigm

Sequence tag IST12369F4BBF1
Sequence
AGTGTGTGGGACACCGAGTCCCGGGGGTGCGCTAGGCAGCCCGGCCCCAGCCTGGTATCACCGTGACCTGAGCCGCGCTG
CTGCGGAGGAGCTCCTGGCTCGGGCGGGCCGCGATGGCAGCTTCCTGGTGCGAGATAGCGAGAGCGTGGCGGGGGCCTTC
GCACTCTGCGTCCTGTGAGTAGGGCGGGCACACGCCGAGTGTTCCTTGGTTGTGGTGGCAATCGTGGTAGTGGGGTGACT
GTAGCTGGTGGGGCTGCANCCCTGTCTCCAGGGGAGACCTTGACTTTNTCGCTGGGTGGAGGAANGATACNGGGGAGCAC
TTCCTGCTGNNCCNGGANCACTTTCTGANGCCCGANNCCNNAGTTCTNAANCTCAN
Sequence Type genomic DNA
Unitrap ID UNI31351

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 108984884..108985258 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032737 (Inppl1) NM_010567 inositol polyphosphate phosphatase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1333787]


Sequence tag IST12369F4HMF1
Sequence
AGTGTGTGGGACACCGAGTCCCGGGGGTGCGCTAGGCAGCCCGGCCCCAGCCTGGTATCACCGTGACCTGAGCCGCGCTG
CTGCGGAGGAGCTCCTGGCTCGGGCGGGCCGCGATGGCAGCTTCCTGGTGCGAGATAGCGAGAGCGTGGCGGGGGCCTTC
GCACTCTGCGTCCTGTGAGTANGGCGGGCACACGCCGAGTGTTCCTTGGTTGTGGTGGCNATCGTGGTAGTGGGGTGACT
GTNNCTNGTGNGGCTGCG
Sequence Type genomic DNA
Unitrap ID UNI31351

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 108985002..108985258 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032737 (Inppl1) NM_010567 inositol polyphosphate phosphatase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1333787]

 
Come back to gene ENSMUSG00000032737


For any suggestions or comments, please send an email to unitrap@crg.es