Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436588
Clone ID OST436588
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436588
Sequence
CTGAGACACGCTATATATGTGATGAACAAGGNCGAGAAAGCAAAGCAGCCACTGGTGCTTGCATGACATGTAATAAACAT
GGATGTCGACAGGCTTTCCATGTAACATGTGCTCAGTTTGCCGGGCTGCTTTGTGAAGAAGAAGGGAATGGCGCAGACAA
TGTTCAATACTGTGGCTACNTGTAAATACCACTTTAGTAAGCNTGAAAAAGAGCAAACGGGGATCTAATAGGTCATATGA
GCAAAGTT
Sequence Type mRNA
Unitrap ID UNI16459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18043870..18047803 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es