Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14808E3
Clone ID IST14808E3
Vector VICTR76
Project tigm

Sequence tag IST14808E3HMF1
Sequence
AGGTCAATGTGCAGCCGAGTGACAGGACAAGGAAGTAGACATGCAGACAACAGACATGCAGGCGAACCACCTCCCTTCTG
TGTTTGGATAAAAGACACACAACAATTTTTATTATTTACAGTAAGCCTTAAAAAGCACTCTGACAGCCACTCAGATATCT
ACCTTCTATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74917307..74917475 165
NO GENE  


Sequence tag IST14808E3BBF1
Sequence
AGGTTTAACGCTCCTGACAGGAAATCCGGGTTTTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI22426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28117087..28117126 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]


Sequence tag IST14808E3HMR1
Sequence
TTACCCCCAGAGCTCCCAGGGACTAAACCACCAACCAAATAGTACACAAGGAGGGACTCAAGGCTTCAGCTGTATATGAG
CAGAGGATGGCCTTGTCTGTCATCAGTGAGAGGAGAGGCCCTTGGCCTTGTGAAGGCTGCATGCATGCCCCAGTGTAGGG
AAGCAGGAGTTGGGTGGGTTAGTGAGCAGGAGGAGGGGGAATGGGATAGGGAATTTTTTGGTGGGGAAATGAGGAAAGGG
GATAAAAATTGAATTGCAAATAAANAAAATATCTAATTNNNANANNNNNANNTTANTGTTAGGGGATGAAGTGGATTGGG
AGAGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI13955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4103644..4103970 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063838 (Cdc42ep5) NM_021454 CDC42 effector protein (Rho GTPase binding) 5 Gene [Source:MGI (curated);Acc:Cdc42ep5-001]

 
Come back to gene ENSMUSG00000063838


For any suggestions or comments, please send an email to unitrap@crg.es