Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10073G5
Clone ID IST10073G5
Vector VICTR75
Project tigm

Sequence tag IST10073G5BBR1
Sequence
AGTAAACACTTGATTTACGAAATTCAGTGATCCCTTTATGGTCTTTAGGTTTGGACCCAGTGTCCCACCACTCTGGAGTT
AGAGGCAGGTGGTCTTTTGAGTTCGAGGCCAGCCTGGTCTACATACTTCCACAGGACAGCCAGGGCTACTCAGTGAGATA
CTGACTCAAAAAAATGGGGGAGGGGGAGTTCGGTCAGTTTGGACCTTAGGACGACTGAATTATATATTGTCCCTTCGTTA
CCGTTTTCGGACATATGCACTATCTAATCTCAGTGTATGAAAATTGTTTTGTTCTGACAAATTGATTGTGAGAACGGCTT
CAAAGTGTGTTTCCCAGTGGCTTGGTTTATTGTGATGGTTTAGGTTATTGAGAATTCAGAATCAAAATATTGGCGGGCAT
GGATGCACGATTTAATGTCAGCACTCAGGAGGCAGAGGCAGGCAGATCC
Sequence Type genomic DNA
Unitrap ID UNI5169

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 92510858..92511306 445
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029405 (G3bp2) NM_001080795 GTPase activating protein (SH3 domain) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442040]

 
Come back to gene ENSMUSG00000029405


For any suggestions or comments, please send an email to unitrap@crg.es