Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10054B3
Clone ID IST10054B3
Vector VICTR75
Project tigm

Sequence tag IST10054B3BBF1
Sequence
GAACACATTGGGAAGCACTCAGTCGTGGAAGAAAGGAAGGCTCTGCTAGTGCTTGTGTTCGCTTGAAAGACATGGTTTCA
GCATTTCTTAGTCTGGTGAACTGTTTTTTCACAACTGAACCTCGGGCTAAGGATTATTTATTTCCTGAACCACTCACTGA
CTGCCCCGTCAGTCAGGAGTCAGTGAACTGGATGTTCCAGTCTGTTTTGCTGAGGCTAGAAAACTGAACCAGTACCCAGC
CAACTTGCAAGTGAGGTTCGAGCCTGTATTAGGGTTGGCTTAGATTAGCCCTGTTTTAAAAGAAAATAAAGGCAGAGTTC
ACAGGTGGGTTCACTGATCTCACAGGTGGAGGTCTGTGAAGTCACACATCCAGGCTAAAGCAAGGGGGTTTTAAAGAGCT
TACGCGAGGAGCAATGATGTGCTAGCCAGGAGCTGGGGCGGTATACATACACAGTCGAATCTGAGCCCCTGGGTGTGCAC
TCTTGGGTGGGTTGCCGGAAATGCGAACGACGATGTTAGCCTGGAGCTTTCTCCAAGAGGTGGGGCAC
Sequence Type genomic DNA
Unitrap ID UNI9030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40776831..40777380 536
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es