Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436357
Clone ID OST436357
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436357
Sequence
CAAAGTCGAACCTCGTTCTGTGGCTGTGTTCCCCTGGCACTCCTTAGTCCCCTTCCTGGCACCCAGCCAGCCCGACCCCT
CTGTGCAGCCTAGTGAGGCCCAGCAACCTGCCAGCCACCCTGTGGCCTCCAACCAGAGCAAAGATTTAAGTAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17470

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26069876..26070017 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es