Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12658D7
Clone ID IST12658D7
Vector VICTR76
Project tigm

Sequence tag IST12658D7BBF1
Sequence
NTNNNCNTATTTNATTTTTTTCTTGTAAATTCCTGCTTTTGATAGGCAAACCAGACCTTCCTCTTCCCTTCCTTAACATT
TCCTCCTCGCACGCTCTGGCGTTCTTTACACCTCCCTTGGCTCCTTTCGGGCTGTCCCCGTCTCCACTCGTCCTTTTCTG
CTTCTCCAGAGGGTTATATAACTCTTCCTCTCCGCGTGTCCTGATTTCAACTCCACAGACTCCGCCCTGGANCGGCNCGG
GAGGGGCGGGAGAGTTGGGGACCCANNCNGATTCCGGCTGGCGGCCANCTGGGGCACAAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69231607..69231904 282
 
EST/CDNA Est Name
  BE995996.1


Sequence tag IST12658D7HMF1
Sequence
ATTTTATTTTGGTTTTTGAGACAGGGTTTCTCTGTATAGCCC
Sequence Type genomic DNA
Unitrap ID UNI11078

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70793002..70793043 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018446 (C1qbp) NM_007573 complement component 1, q subcomponent binding protein Gene [Source:MGI (curated);Acc:C1qbp-001]

 
Come back to gene ENSMUSG00000018446


For any suggestions or comments, please send an email to unitrap@crg.es