Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11772H4
Clone ID IST11772H4
Vector VICTR76
Project tigm

Sequence tag IST11772H4HMF1
Sequence
CTAGAAACGATCNNACTCCACTTCTCCTTGTCCTCANCTCCCTCACATGGGCCACACCCCCGCCTCCAGAAAGTACTAGT
CCTGTTTTCTAGGCAACTCTCCGAAAGGACTTGAAAGACTCTTGGTTGANAGCCTANATTTGTTCTGAGCTANCCTCACC
CTGCCTCCTANAAAACTTGGGTTTTCTTTGAACCTNANAGTACTGCCTCCATGCTCATATCTTCCAAAGACGCCTGTCCC
TTGATTCNTCTANACTGANGTGGCTCCCCTCTGCCTCCTTTTGTATGGCTGTGGCTCANAAAATCACACACACACACACA
CACACNCCTNCNANGACANCCCGGGCTGTNTGCTCNCTNNTTNCNNTGAGTGCANCTGTCTCCNNCTGTTNNNGGNNGCC
CNATGGNANGAANGNAGGGGNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11772H4BBF1
Sequence
CTAGAAACGATCAGACTCCACTTCTCCTTGTCCTCAGCTCCCTCACATGGGCCACACCCCCGCCTCCAGAAAGTACTAGT
CCTGTTTTCTAGGCAACTCTCCGAAAGGACTTGAAAGACTCTTGGTTGAGAGCCTAGATTTGTTCTGAGCTAGCCTCACC
CTGCCTCCTAGAAAACTTGGGTTTTCTTTGAACCTCAGAGTACTGCCTCCATGCTCATATCTTCCAAAGACGCCTGTCCC
TTGATTCGTCTAGACTGAGGTGGCTCCCCTCTGCCTCCTTTTGTATGGCTGTGGCTCAGAAAATCACACACACACACACA
CACACNCNTT
Sequence Type genomic DNA
Unitrap ID UNI22426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28116384..28116708 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es