Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST436294
Clone ID OST436294
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST436294
Sequence
TGAGGTGCGGCCAAACGTAGACAAGTATGAGCTGTTTGAAAAGCTGGAACTTGTGAAGGGCCAGAAGCGGAAGGTGAAGG
ACCGTCTGAAGGCCTACGTGCGCGACCCCTATGCTCTGGACCTCATTGACAAGCTGCTGGTGCTGGACCCCGCGCAGCGG
ATTGACAGTGACGATGCCCTCAACCACNGACTTCTTCTGGTCGGACCCCATGCCCTCGGACCTCAAGGGCATGCTGTCTA
CTCACTTGACGTCTATGTTTGAGTACCTGGCACCGCCACGGCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAG
AGCAGAAATCCCGCCACCACCAACCAGACGGAATTTGAACGTGTCTTCTGAGGCCGGAACTGGCCGGTGTTGTTCTTAGG
TTAGGAGTGGATTGCTTCCTTTGCATGGAACATGTGACATGATGGGACATTTGAGATTTTCTCCTCCAGTACATATTAAC
TCCCACCCTGGCACTGGGAACAGCTGCCT
Sequence Type mRNA
Unitrap ID UNI17797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32563306..32563811 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009555 (Cdk9) NM_130860 cyclin-dependent kinase 9 (CDC2-related kinase) Gene [Source:MGI (curated);Acc:Cdk9-001]

 
Come back to gene ENSMUSG00000009555


For any suggestions or comments, please send an email to unitrap@crg.es