Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13549C1
Clone ID IST13549C1
Vector VICTR74
Project tigm

Sequence tag IST13549C1HMR1
Sequence
NNGGNNNNACCNGTTGAGATAAACTAACATTTCANATCTTAACATCCGTCCAGTTTCACTGGCTCCAGAGAGGACAGTCA
CTGAGGTTGGTAACTAGGGGTGTCACCCAGAGTGTTTCCCGTGTGGAAAAATGAGTTATAAGAACAATTGAGGAGGACAT
TATGTACCAGGGCAAGGGCTGAGAGCATGAAGCTAATCCTCACTGTCCACTCTTACAGCCTGTGCTTCCCACAGAAGCCA
AATTTAGTCAGGAACGCGTGCCCTTTCACTGAACACGCAGCCTGCACGAGGGGCAGACACCAGGGCACACCTGACNCNCA
NCCCTTGCACANNNNTGGGATTAACCTTATTTTCATATACTGACTCCATGGGGATGAAAGCTTATTCCATCATACATGTT
TCAAAGGGAAAGAAAGAAATTCCTACACATGACNTGCAGGGTGTGGTGTCTCAAGTCTGTNAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71192059..71192510 432
 
EST/CDNA Est Name
  BE912090.1 - BB618078.1 - CJ092515.1 - BB653264.1 - BF137858.1 - CX123275.1 - BQ942112.1 - BU918225.1 - BE533043.1 - CA555919.1 - BE310301.1 - BF142058.1 - BB852770.1 - BY269876.1 - BY258620.1 - BY296846.1 - BY004613.1 - CJ170213.1 - BY013210.1 - BY011403


Sequence tag IST13549C1BBF1
Sequence
TTGGAGACACAGTTTTGACTCAGGTTACAGCCGAATGTTGGATATGCAGAGAGAGCTGCTTAGAGCTGTCACGGCTGACC
TGCTGGCAAGCTGACCCCTAGGCAACCTTGGTTTGAAAGGCANAGAGGAANAAGAGTAACCCTTTCATGTTAGGAGAAAA
GCAAGAAGTTCTGTAAGGAGGGAACTTCCCTTCTGTTTGTAAGTGTGCTCCCCTCCCCCACCANACAGGCTTTCTCCNTG
TANCCCTGGCTGTCCTGGAACTCAGTTGATAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71191774..71192051 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es