Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14991A4
Clone ID IST14991A4
Vector VICTR78
Project tigm

Sequence tag IST14991A4HMF1
Sequence
CACAGCATGTCTGGGTTAGTAGGTAAAACCAATCAAACAAACCAATAAACAAAAATCCCCGATTTCCATCTTACAAAAGA
CACAAATAAGCTCAGAGAAGTAAGGATCTTGGCTAAGGTCACACAAAGGAAGGGACAGACTCAGCATTTGATTTCTGGGT
ATATGACTTCAAAGCCCAGACTCTTAGCAACTTTCATATATATCTTTCACAAATCAATAGCTTTTGGCTAGGACTTGTCT
CTCTTCATGCCCCCCCATCTCTGTGGGGAGCAGGAGCCTTTTGANACCTTTGTGACCCANAATTTGATGGGCTGTTTCNN
GGCCTACNTTCTNANCTGGATTTNTTNAAAANTTTAN
Sequence Type genomic DNA
Unitrap ID UNI23051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4968070..4968425 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051184 (Zfp524) NM_025324 zinc finger protein 524 Gene [Source:MGI Symbol;Acc:MGI:1916740]


Sequence tag IST14991A4HMR1
Sequence
CTGTGAACATAAGAGCCNGCACTACAGCACTGGTCGTTGAGCCTCACAGCAATCCTCTGAGGGAACATTTTCAAAGGGTT
TCATTTGGATCCAGTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4967978..4968074 95
NO GENE  


Sequence tag IST14991A4BBF1
Sequence
CACAGCATGTCTGGGTTAGTAGGTAAAACCAATCAAACAAACCAATAAACAAAAATCCCCGATTTCCATCTTACAAAAGA
CACAAATAAGCTCAGAGAAGTAAGGATCTTGGCTAAGGTCACACAAAGGAAGGGACAGACTCAGCATTTGATTTCTGGGT
ATATGACTTCAAAGCCCAGACTCTTAGCAACTTTCATATATATCTTTCACAAATCAATAGCTTTTGGCTAGGACTTGTCT
CTCTTCATGCCCCCCCATCTCTGTGGGGAGCAGGAGCCTTTTGAGACCTTTGTGACCCAGAATTTGATGGGCTGTTTCAA
GGCCTACATTCTTAGCTGGATTTTTTCAAAAATTTATTTATTTTTGGCTTGTTTTGACTTTAAAGGCNNTTTGTANTNAT
GTTGANGTNNTGAAAAACNNTGACNNTNNCANCGTATAAAGAAAN
Sequence Type genomic DNA
Unitrap ID UNI23051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4968070..4968513 416
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051184 (Zfp524) NM_025324 zinc finger protein 524 Gene [Source:MGI Symbol;Acc:MGI:1916740]

 
Come back to gene ENSMUSG00000051184


For any suggestions or comments, please send an email to unitrap@crg.es