Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11443E4
Clone ID IST11443E4
Vector VICTR76
Project tigm

Sequence tag IST11443E4HMF1
Sequence
AAAGGTGTGCTCCATCACGCCTTGTTCTTGANATTANTGCCCATATGGTCCGGACCTTCCTCAGTCTTCTTTGTTTGAGG
TGACTGTTGGCTTCTTAAATAAAACCCAAAGGCCCTGAAAAGCTATCCATTGGCCCTGTTGGCCTCCCTCCAGCCAGGTA
GTGCTGGGGTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104155212..104155390 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST11443E4BBF1
Sequence
AAAGGTGTGCTCCATCACGCCTTGTTCTTGAGATTANTGCCCATATGGTCCGGACCTTCCTNAGTCTTCTTTGTTTGAGG
TGACTGTTGGCTTCTTAAATAAAACCCAAAGGCCCTGAAAAGCTATCCATTGGCCCTGTTGGCCTCCCTCCANCCAGGTA
GTGCTGGGGTTTTTTTTTTG
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104155212..104155390 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es