Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14859A4
Clone ID IST14859A4
Vector VICTR76
Project tigm

Sequence tag IST14859A4HMF1
Sequence
GTACAGCCGCCGCTTTCGTACCATCGACATCGAACCTGACATAGAAACCCTGCTGTCCCAGCAGTCTGGCAACTCCTAAG
GCGGCCCTGGCATTGGCTTGGTGATTACTGGCTGCACTCTGGGGGGCGGTTCTTCCATGATGGTGTTTCCTCTAAATTTG
CACGGAGAAACACCTGATTTCNNNGAAAATCCCCTCANATGGGCGCNNGNCCCATCCATTCCNNATGCNNTTN
Sequence Type genomic DNA
Unitrap ID UNI12653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108242389..108242616 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063856 (Gpx1) NM_008160 glutathione peroxidase 1 Gene [Source:MGI Symbol;Acc:MGI:104887]


Sequence tag IST14859A4BBF1
Sequence
GTACAGCCGCCGCTTTCGTACCATCGACATCGAACCTGACATAGAAACCCTGCTGTCCCAGCAGTCTGGCAACTCCTAAG
GCGGCCCTGGCATTGGCTTGGTGATTACTGGCTGCACTCTGGGGGGCGGTTCTTCCATGATGGTGTTTCCTCTAAATTTG
CACGGAGAAACACCTGATTTCCAGGAAAATCCCCTCAGATGGGCGCTGGTCCCATCCATTCCCGATGCCTTTCCACCTAA
TGAAAGGTGGTTTCACTACTAAGAATAAAGTGCTGAATATCNNAATTGTTTGTGTGTCCTGTGTCNTTGTCACCTTTTGG
ATANCCTCATAGTCAGGGATAAGGAACTCAATCCCAGANCCTANNCGTCCCTTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108242389..108242764 362
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063856 (Gpx1) NM_008160 glutathione peroxidase 1 Gene [Source:MGI Symbol;Acc:MGI:104887]

 
Come back to gene ENSMUSG00000063856


For any suggestions or comments, please send an email to unitrap@crg.es